[صفحه اصلی ]   [Archive]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: تمام شماره‌ها :: جستجو :: ثبت نام :: ارسال مقاله :: تماس با ما ::
بخش‌های اصلی
صفحه اصلی::
اطلاعات نشریه::
آرشیو مجله و مقالات::
برای نویسندگان::
برای داوران::
ثبت نام و اشتراک::
تماس با ما::
::
جستجو در پایگاه

جستجوی پیشرفته
..
دریافت اطلاعات پایگاه
نشانی پست الکترونیک خود را برای دریافت اطلاعات و اخبار پایگاه، در کادر زیر وارد کنید.
..
:: دوره 3، شماره 1 - ( 10-1392 ) ::
برگشت به فهرست نسخه ها
Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences
:   (10375 مشاهده)
Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557 Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome.
متن کامل [PDF 97 kb]   (3560 دریافت)    
نوع مطالعه: Original Article | موضوع مقاله: Bioinformatic
دریافت: 1392/8/16 | پذیرش: 1392/10/11 | انتشار: 1392/10/30
ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Motalleb G. Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences. Int J Mol Cell Med 2014; 3 (1) :43-50
URL: http://ijmcmed.org/article-1-119-fa.html

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences. مجله بین المللی سلولی و مولکولی. 1392; 3 (1) :43-50

URL: http://ijmcmed.org/article-1-119-fa.html



بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.
دوره 3، شماره 1 - ( 10-1392 ) برگشت به فهرست نسخه ها
International Journal of Molecular and Cellular Medicine (IJMCM) International Journal of Molecular and Cellular Medicine (IJMCM)
Persian site map - English site map - Created in 0.05 seconds with 37 queries by YEKTAWEB 4645